Informatie

12.10: Waarom het ertoe doet - DNA-transcriptie en -vertaling - Biologie

12.10: Waarom het ertoe doet - DNA-transcriptie en -vertaling - Biologie



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Waarom de omzetting van DNA naar RNA naar eiwitten beschrijven?

Je bent inmiddels bekend met genen en DNA-sequenties en hoe veranderingen in het DNA een grote impact kunnen hebben. hoe? Hoe zorgt DNA ervoor dat er iets gebeurt?

Ons lichaam bevat biljoenen cellen die op zeer nauwkeurige manieren moeten worden geconstrueerd. Net zoals wanneer een bouwbedrijf blauwdrukken maakt voordat ze daadwerkelijk aan een project beginnen, heeft je lichaam een ​​soort plan nodig om dit te bereiken.

DNA fungeert als een blauwdruk. Met dit plan in elke cel is je lichaam in staat om via een intermediair, RNA, DNA om te zetten in actiemoleculen, dit zijn eiwitten. Dit idee staat zo centraal in de biologie dat het vaak het centrale dogma van de biologie wordt genoemd: DNA wordt getranscribeerd naar RNA dat wordt vertaald naar eiwit. Dit meerstappenproces is een van de redenen voor de diversiteit die we in de wereld om ons heen zien.

Leerresultaten

  • Schets het proces van eukaryote transcriptie
  • Vat het vertaalproces samen
  • Schets het proces van prokaryotische transcriptie en translatie
  • Identificeer het centrale dogma van het leven

Darwins God

Elke biologiestudent leert over twee enorme machines die op het DNA-molecuul werken. Er is de transcriptiemachine die een enkelstrengs kopie van een gen maakt, en er is de replicatiemachine die een dubbelstrengs kopie van de dubbele DNA-helix maakt. De eerste is de eerste stap in het eiwitsyntheseproces, terwijl de laatste deel uitmaakt van het celdelingsproces. Maar wat gebeurt er als deze verschillende machines elkaar ontmoeten terwijl ze op hetzelfde stuk DNA werken? Wat zijn de regels van de DNA-weg?

Nieuw onderzoek suggereert dat het zeer ingewikkelde replicatieproces niet wordt gedestabiliseerd door frontale botsingen met de transcriptiemachine, maar alleen pauzeert terwijl het de indringer verdringt. Om dit te doen gebruikt het een eiwit dat anders helpt bij transcriptieherstel. Zoals de krant uitlegt:

Het is onderzoek dat zowel belangrijk als interessant is. En, zoals bij elke nieuwe bevinding, kan het relevant zijn voor de kwestie van evolutie. Misschien had de evolutietheorie ons bijvoorbeeld ertoe gebracht deze bevinding te voorspellen. Of, bijna net zo goed, misschien wordt de bevinding redelijkerwijs afgeleid uit de theorie.

In dit geval zou zo'n retrodictie ongeveer als volgt gaan: als evolutie waar is, zouden we verwachten dat de replicatiemachine de transcriptiemachine verdringt, omdat willekeurige mutaties tot zo'n ontwerp kunnen leiden, maar niet tot andere denkbare ontwerpen.

Maar wat als aan de andere kant de evolutie zo'n ontwerp niet goedkeurde? Wat als zo'n voorspelling of retrodictie er niet was? Dan zou het moeilijker zijn om het ontwerp in te schakelen als ondersteuning voor evolutie. In feite, wat als evolutie geen plausibele verklaring heeft voor het ontwerp?

In dit geval is het waarschijnlijk niet waarschijnlijk dat de replicatie- en transcriptiemachines met succes hun weg banen in de drukke omgeving, frontale botsingen oplossen en een gevestigde 'rules-of-the-road' hebben, gezien de willekeurige biologische variatie van de evolutie. onder de wannende hand van natuurlijke selectie. Hier zouden we een bevinding hebben die niet past in de evolutionaire verklaring, en het bewijs verschuift van de plus-kolom naar de min-kolom.

Wat interessant is, is hoe evolutionisten routinematig op dergelijke bevindingen reageren. Wanneer evolutionisten dergelijke ontwerpen voorgeschoteld krijgen, werpen ze bijna altijd een reeks misleidende wegversperringen op. Je kunt zien dat dezelfde wegversperringen herhaaldelijk worden gebruikt, en ze spreken boekdelen over evolutionair denken.

Een zo'n misleidende wegversperring is dat het plaatsen van dergelijk bewijs in de min-kolom neerkomt op een argument uit ongeloof. “Je kunt je niet voorstellen hoe evolutie zo'n ontwerp heeft kunnen maken,' zeggen evolutionisten, 'en dus denken jullie dat het bewijs tegen evolutie is.' Het is een vreemd argument dat de last op de ene legt het evalueren van een theorie ook om de theorie te verdedigen.

In feite kan iedereen zich 'verbeelden' hoe de evolutie het ontwerp zou hebben opgebouwd, maar wat nodig is, is een plausibele verklaring. Evolutionisten willen dat we gewoon een leeg verhaal accepteren. Het probleem is niet het ongeloof van de beoordelaar, maar goedgelovigheid van de kant van de evolutionist. 'Maak je geen zorgen, het is geëvolueerd' is geen plausibele verklaring.

Deze bedrieglijke klacht van evolutionisten is ook een ander teken van het protectionisme dat door het evolutionaire denken loopt. Als bevindingen die een theorie niet verklaart niet in de min-kolom mogen staan, wat zou dan de theorie kunnen schaden? Het is de ultieme vorm van onvervalsbaarheid. Bewijzen die door de theorie worden verklaard, maken het een feit en DNA-regels van de weg tellen niet mee, want dat zou een argument zijn uit ongeloof.

81 opmerkingen:

Dat argument van de ongeloofkaart is aan de randen erg gerafeld. Maar het moeilijke is dat al hun kaarten aan de randen erg gerafeld zijn. Handige manier om je te laten raden, hè.

Wat op zijn zachtst gezegd ook interessant is, is hun aandringen dat hun 'bergen' van bewijs voor evolutie niet neerkomen op een argument uit ongeloof.

Rechter: "Wel meneer, welk hard bewijs heeft u om te bewijzen dat evolutie waar is?"

Coyne: "Ten eerste, edelachtbare, de wetenschap probeert niets anders te 'bewijzen' dan de beste verklaring te vinden op basis van het bewijs. De wetenschap staat altijd open voor correctie. Hoe dan ook, we hebben veel informatie waarmee we een redelijke conclusie kunnen trekken over wat er is gebeurd."

Rechter: "Vertaling, je hebt geen hard bewijs maar heel veel indirect bewijs".

Coyne: "Nou, zo zou ik het niet zeggen, maar in wezen wel."

Rechter: "Heel goed. [wendt zich tot de Meyer]. En u meneer, welk direct bewijs heeft u om uw standpunt te bewijzen dat het leven is ontworpen en niet alleen in natuurlijke termen kan worden uitgelegd zoals meneer Coyne inhoud?'

Meyer: "Ten eerste edelachtbare, de wetenschap probeert niets anders te "bewijzen" dan de beste verklaring te vinden op basis van het bewijs. De wetenschap staat altijd open voor correctie. Hoe dan ook, ik heb ook veel bewijs dat ons in staat stelt om een ​​redelijke conclusie te trekken (ik geloof de beste conclusie) dat het leven is ontworpen.

Rechter: "Vertaling, u hebt ook geen hard bewijs, maar heel veel indirect bewijs, toch?".

Meyer: "Ja, eh, dat klopt, edelachtbare. Ik wil mijn gevolgtrekking tot de beste verklaring afzetten tegen de gevolgtrekking van de heer Coyne tot de beste verklaring, aangezien we geen van beiden enig direct bewijs hebben.

Rechter: "Alight, hier zijn de basisregels. Punten voor logische, goed beredeneerde argumenten en minpunten voor alle gewoon-zo-verhalen. Aan het eind van de dag zal ik ze optellen en degene met de meeste punten wint de zaak.

Steve: "Rechter: "Step, hier zijn de basisregels. Punten voor logische, goed beredeneerde argumenten en minpunten voor alle gewoon-zo-verhalen. Aan het eind van de dag tel ik ze op en degene met de meeste punten wint de zaak."

Ja, dat is precies wat er gebeurde in Kitzmiller tegen Dover. De IDCer had alle kans om hun zaak voor de wereld te verdedigen, en ze deden een complete gezichtsplant. Dembski schrok en maakte een zwak excuus om niet te getuigen. Behe getuigde wel en maakte zichzelf een totale dwaas door zijn gebrek aan kennis over het huidige wetenschappelijk onderzoek. De rest van de IDC'ers deden hun best als clowns die uit hun piepkleine circusauto stapten. Als het een voetbalwedstrijd was geweest, was de eindscore ongeveer 137-0, IDC verloren. "Adembenemende waanzin" inderdaad.

Sindsdien is IDC vrijwel van de radar verdwenen. Er zijn een paar geïsoleerde websites zoals: Ongewoon dicht en deze, bevolkt door een overgebleven handvol hopeloos wetenschappelijk onwetende ware gelovigen. Een beetje zoals de weinige arme Japanse soldaten op geïsoleerde onbewoonde eilanden die na 1945 jarenlang doorvochten, niet wetende dat de Tweede Wereldoorlog was geëindigd.

Ach, het is nog steeds goed vermaak om te zien hoe ze nieuwe en andere manieren bedenken om zichzelf voor schut te zetten.

"Eigenlijk kan iedereen zich “ voorstellen” hoe evolutie het ontwerp zou hebben opgebouwd, maar wat nodig is, is een plausibele verklaring."

Welnu, hier is een werkhypothese:

Head-to-head botsingen zijn rampzalig zonder machines om ze op te lossen. Uit andere onderzoeken blijkt echter dat kop-staartbotsingen de replicatievork niet afslaan.

Dus ik veronderstel dat primitieve genomen waren georganiseerd met oorsprong en promotors in dezelfde oriëntatie. Interessant is dat moderne bacteriële genomen 80-98% van hun rRNA-genen hebben, en significant meer dan 50% van hun genen co-georiënteerd met de oorsprong van replicatie. Sommige virussen (en ik denk mitochondriën) hebben volledig dezelfde oriëntatie.

Later evolueert MFD1 - het lijkt op helicases en helpt RNA-polymerase los te maken in een aantal gebroken DNA-contexten. Het werkt ook bij kop-tot-kop botsingen.

Dit maakt een dynamischer genoom mogelijk, recombinatie zonder de oriëntatie te respecteren. voordelig. Bacteriën beginnen genen op beide strengen te plaatsen, met meer complexe regulatie.

Nu, als test, kon ik testgenomen synthetiseren met en zonder co-oriëntatie, en de essentie van zo'n eiwit in elk ervan onderzoeken.

Ik zou ook gedetailleerde fylogenie kunnen doen op Mfd - hoe oud is het, waar heeft het het meest mee te maken. Ontbreken er organismen en hoe gaan ze om met botsingen?

Ik zou zelfs enkele rRNA-genen in E. coli kunnen omkeren, testen op nadelige effecten en kijken of overexpressie van Mfd werkt om te compenseren.

Ik weet zeker dat er veel meer is om zo'n verhaal op te ruimen, maar het is niet mijn vakgebied en het is laat. Desalniettemin hoop ik dat dit laat zien hoe een plausibele hypothese kan worden vastgesteld en getest. Je had iets kunnen bedenken (waarschijnlijk beter) maar koos ervoor om dat niet te doen. Dat is wat design suggereert: stop met nadenken over hoe, stop met onderzoeken. Waarom vragen hoe, als dat al is beantwoord?

"Evolutionisten willen dat we gewoon een leeg verhaal accepteren"

Nee, we willen gedetailleerd empirisch onderzoek doen, en niet dat je de evolutiebiologie voorstelt als een veld dat leeg is van proces en vooruitgang, dat zijn handen in de lucht steekt als het 'complexiteit' ziet.

" Sindsdien is IDC zo goed als van de radar verdwenen. "

Je zou cabaretier moeten worden.
Je logica en je pseudowetenschap zijn inderdaad erg humoristisch.

Verbazingwekkend hoe darwinisten niet kunnen zien dat zij degenen zijn die niet kunnen achterhalen wat waarschijnlijkheden betekenen en waarom het belangrijk is in de biologie.

Jullie hersendode darwinistische fundamentalisten zouden jullie zwakke en onwetende redeneringen "The Worrell Family Science Emporium" moeten noemen.

Rob zei: ". Ik weet zeker dat er veel meer is om zo'n verhaal op te ruimen"

Daar gaan we weer, weer een ander verhaal dat doorgaat voor een plausibel mechanisme.

Je leert nooit dat wetenschap geen verhalen vertellen is en dat vermoedens en speculaties geen feiten zijn.

Je bent dol op het napraten van deze veronderstelde 'waarschijnlijkheden'. Wil je ons een voorbeeld geven en wat wiskunde toepassen op dit systeem?

Thorton, dus wat is je antwoord op het artikel? Ik denk dat u weet dat de Dover-zaak in wezen zinloos was, aangezien de rechter grote delen van het ACLU-script woordelijk in zijn uitspraak heeft gekopieerd. ID heeft zeker de beste verklaring voor het bewijs. Evolutionisten zijn gedwongen te vertrouwen op talloze wonderen om hun theorie te redden. We weten allemaal dat zinvolle of gespecificeerde informatie niet zomaar uit een toverhoed komt. Complexe lichaamsplannen ontstaan ​​niet in een geologische oogwenk. (Cambrische explosie) Vertrouwen op het multiversum, zodat het verhaal geen stellaire evolutionaire ideeën kan redden. Prachtig ontworpen machines ontstaan ​​niet zomaar. Protectionisme zou niet nodig zijn als er echt goed bewijs was om de oppositie het zwijgen op te leggen. Als jouw wereldbeeld je niet blind heeft gemaakt voor de waarheid, zou je een geweldig inzicht hebben. Wen maar beter aan ID-ideeën. Het wordt vanaf nu alleen maar erger. Als het goed amusement voor je is, dan heb je geluk, maar een dezer dagen heb ik het gevoel dat het niet meer zo grappig zal zijn en een serieuze zaak zal worden. Veel mensen vragen zich al af of het niet de evolutionisten zijn die zichzelf in verlegenheid brengen vanwege hun onwankelbare, schijnbaar onwrikbare geloof in pater Charlie.

"Gespecificeerde informatie komt niet zomaar uit een toverhoed"

Hoeveel gespecificeerde informatie bevat Mfd? Hoeveel eenheden gespecificeerde informatie is het van zijn naaste verwant?

LOL! ik heb gewoon Liefde de IDC-mondademhalers die uit het houtwerk komen om dezelfde oude lege poespas te spuiten. "ID neemt de wetenschap over!! Evolutie ligt op zijn sterfbed!! Oh God, het is ZO complex, het MOET gewoon ontworpen worden!!"

Als jullie stoppen met je kauwgom te slaan en echt positief bewijs produceren door je onderzoek, zal de reguliere wetenschap misschien stoppen met lachen.

Hier is het totaal van ID 'theory' tot nu toe:

"Een onbekende ontwerper op een onbekende plaats en onbekende tijd met onbekende materialen met een onbekend proces en om onbekende redenen iets vervaardigd".

Voel je vrij om meer details te verstrekken, wanneer je maar wilt.

Dit is het grote ding dat jullie IDC'ers nog niet hebben ontdekt:

Alleen omdat de wetenschap niet alle details heeft ontdekt van alles wat er in de afgelopen 3,3 miljard jaar is gebeurd in evolutionaire processen betekent niet dat ID standaard wint.

De wetenschap is volkomen in orde met te zeggen: "Ik weet het niet, dus ik zal er meer onderzoek naar doen" voor gebieden als abiogenese of de oorsprong van DNA-replicatie. IDC'ers denken dat "ik weet het nog niet" gelijk staat aan "MIJN Intelligent Designer moet het gedaan hebben!!" Het is dezelfde domme valse dichotomie waar ID al jaren mee leeft. ID'ers doen graag alsof er maar twee categorieën zijn

1) Natuurlijke processen deden het
2) ID deed het.

In werkelijkheid zijn er drie categorieën

1) Natuurlijke processen die we momenteel begrijpen, deden het.
2) Natuurlijke processen die we momenteel niet doen begrijp deed het
3) ID deed het.

Gewoon omdat sommige gegevens niet in categorie 1) niet betekent dat het automatisch in 3) valt. Dat is waarom de wetenschap vereist: positief bewijs voor een functie, niet alleen "ToE kan dit niet verklaren, zodat ID wint. En positief bewijs voor ID is iets wat je hebt NUL van.

“Je had iets kunnen bedenken (waarschijnlijk beter)”

In plaats van dat 'primitieve genomen werden georganiseerd met oorsprong en promotors in dezelfde oriëntatie', zou ik ze vanaf het begin willekeurig georiënteerd hebben, waarbij ik elke suggestie van teleologie of ontwerp zou vermijden, en in overeenstemming met het evolutionaire thema van willekeur. Vervolgens zou ik als consequentie hebben dat de transcriptie mislukt. Dit, zo zou kunnen worden betoogd, was slechts licht toevallig, als we de (waarschijnlijk meer waarschijnlijke) consequentie vermijden dat beide falen, en het presenteren als een 50/50-zaak. Met aanhoudende replicatie (i) vermijd je het fatale probleem dat reproductie niet werkt en (ii) heb je een mooi vervolg op het bestaande ontwerp.

En als de transcriptie faalt, heb je gewoon meer nutteloos DNA. Hoe zijn functionerende gensequenties in de eerste plaats ontstaan? Wie weet, maar er waren zeker genoeg nutteloze segmenten. Dus wat als je wat meer nutteloze segmenten hebt als gevolg van frontale ontmoetingen. Je zou ook kunnen stellen dat in zulke primitieve vormen deze rechtstreekse ontmoetingen niet zo vaak voorkwamen, omdat … transcriptie niet zo gebruikelijk was, of replicatie niet zo gebruikelijk was, of beide, of … wat dan ook.

Later evolueerde MFD1 omdat het RNA-polymerase hielp zijn werk te doen. Maar de functie was enigszins flexibel of slordig, zodat het soms meerdere taken kon uitvoeren. Deze werden verfijnd, en dus had je een divergentie van functionaliteit, omdat er meerdere, goed ontwikkelde, functies ontstonden. In het geval van de frontale ontmoetingsfunctionaliteit hielp MFD1 om RNA-polymerase op een meer geordende manier te verdrijven, waardoor de kans op een succesvolle herstart werd vergroot. Dit opende ongeveer de helft van het genoom voor succesvolle transcriptie, wat trouwens steeds belangrijker werd omdat de transcriptie- en replicatiefrequenties waarschijnlijk aanzienlijk toenamen.

Natuurlijk was een groot deel van het nieuw getranscribeerde genoom rommel, maar er kunnen enkele bruikbare sequenties zijn geweest. En dat zou in ieder geval de selectiedruk op die helft hebben vergroot.

Daar heb je het, evolutie gebeurt.

Helaas is dit scenario, of het uwe zo u wilt, geen plausibele verklaring. Er ontbreken substantiële details die geen teken van gemakkelijk zijn (daarom ontbreekt het). Wat nog ongelukkiger is, is dat evolutionisten zich niet bewust zijn van dit probleem. Afgezien van het af en toe beschuldigen van 'just-so-verhalen' tegen subhypothesen waar ze niet de voorkeur aan geven, construeren evolutionisten routinematig hun eigen just-so-verhalen. Maar het is gemakkelijk om dergelijke problemen niet op te merken als het overkoepelende idee een feit is. Het probleem van het verklaren van ontwerpen, zoals de DNA-regels van de weg, is niet om de aannemelijkheid van evolutie te rechtvaardigen, maar om een ​​proces op te helderen dat op de een of andere manier moet hebben plaatsgevonden. Het is een kwestie van *hoe* het werkte, niet *of* het werkte, en de lat wordt steeds lager gelegd. Voor evolutionisten is wat doorgaat als “plausible” verbazingwekkend.

"Een zo'n misleidende wegversperring is dat het plaatsen van dergelijk bewijs in de min-kolom neerkomt op een argument uit ongeloof. “Je kunt je niet voorstellen hoe evolutie zo'n ontwerp heeft kunnen maken,' zeggen evolutionisten, 'en dus denken jullie dat het bewijs tegen evolutie is.' Het is een vreemd argument dat de last op de ene legt het evalueren van een theorie ook om de theorie te verdedigen."

Het is een voorbijgaand vreemd (ahem!) argument, nietwaar? En tegelijkertijd legt het de nieuwsgierige goedgelovigheid van darwinisten, nietwaar?

"Maar wat gebeurt er als deze verschillende machines elkaar ontmoeten terwijl ze op hetzelfde stuk DNA werken? Wat zijn de regels van de DNA-weg?

Nieuw onderzoek suggereert dat het zeer ingewikkelde replicatieproces niet wordt gedestabiliseerd door frontale botsingen met de transcriptiemachine, maar alleen pauzeert terwijl het de indringer verdringt."

Ik weet niet of ik dit goed begrijp, want ik ben geen bioloog.

Ik ben echter een computerontwikkelaar en wat hier wordt beschreven, klinkt ongeveer als threadbeheer.

Stel dat u twee gebruikers hebt die toegang hebben tot dezelfde variabele. De twee gebruikers voeren code uit in verschillende threads, maar de twee threads gebruiken dezelfde variabele. Hoe voorkom je allerlei rare anomalieën wanneer verschillende threads dezelfde variabele willen wijzigen? U voegt een slot toe aan het codegedeelte: dit betekent dat wanneer de eerste thread het slot binnengaat, deze exclusieve rechten heeft om deze uit te voeren. De tweede thread moet wachten tot de eerste thread het slot verlaat, voordat de tweede thread kan doorgaan.

Het is absoluut opmerkelijk hoe DNA lijkt op computerprogrammering. Niet alleen in het simplistische, zoals syntaxis, maar ook in de meer geavanceerde gebieden.

Het zou me niet verbazen als we objectgeoriënteerde programmering in DNA zouden ontdekken, waarbij logica is ingekapseld in functies, die vanuit andere delen van het DNA worden aangeroepen, in plaats van dezelfde logica te laten dupliceren waar dat ook maar nodig is.

Oh, en ik zou alle darwinisten uitdagen om me een natuurlijk proces te laten zien dat in staat is om computercode te produceren. Ik denk dat het darwinisme intellectueel bankroet is en dat het hele fundament gebaseerd is op ongegronde beweringen.

Hanno,
je krijgt misschien een "orkaan"-antwoord zoals ik een paar dagen geleden deed toen ik een soortgelijke vraag stelde.

Hanno: "Oh, en ik zou elke darwinist uitdagen om me een natuurlijk proces te laten zien dat in staat is om computercode te produceren. Ik denk dat het darwinisme intellectueel bankroet is en dat het hele fundament gebaseerd is op ongegronde beweringen. "

LOL! een ander computerwetenschapper die het verschil niet begrijpt tussen analogieën en de realiteit. Te grappig.

Wanneer wetenschappers spreken over DNA 'code', gebruiken ze een brede definitie van code als 'elk proces dat een specifieke input koppelt aan een specifieke output'. Computercode valt onder a verschillend definitie van "code": "een systeem van het gebruik van abstracte symbolen om een ​​bericht via een medium door te geven." IDCers houden ervan om dubbelzinnig te zijn over de twee definities.

Computercode wordt gebruikt als een analogie voor DNA-functie, maar zoals alle analogieën breekt het af als het nauwkeurig wordt onderzocht. In de fundamentele mechanica werken de twee totaal anders. Gebruik van computercode abstracte symbolen informatie doorgeven aan de machine die het werk doet. De symbolen zijn: onafhankelijk van het medium en moet op een ander moment worden geïnterpreteerd om bewerkingen uit te voeren. DNA daarentegen is niet abstract helemaal niet. Het is een fysiek molecuul dat deel uitmaakt van een zichzelf in stand houdende chemische reactie (toegegeven een verbazingwekkend gecompliceerde). Een reactie die alleen de wetten van scheikunde en natuurkunde volgt om door te gaan. Het is helemaal afhankelijk op zijn fysieke structuur. Een model van DNA gemaakt van stokken en klei en zal niet code voor een eiwit, hoe hard je ook bidt.

Ik zou elke IDCer willen uitdagen om aan te tonen dat DNA berust op abstracte symbolen die moeten worden geïnterpreteerd, onafhankelijk van het transmissiemedium, zoals computercode dat doet.

Probeer het andersom:
computerprocessor verplaatst elektronen gewoon omdat sommige andere elektronen aan de elektronenopslagmatrix van de processor werden gepresenteerd, zodat het ze tegen elkaar dwingt.
Elektronenbundels bewegen gewoon volgens natuurwetten

Dit antwoord van de evolutionist spreekt boekdelen.

====
LOL! nog een computerwetenschapper die het verschil tussen analogieën en realiteit niet begrijpt. Te grappig.

Wanneer wetenschappers spreken over DNA 'code', gebruiken ze een brede definitie van code als 'elk proces dat een specifieke input koppelt aan een specifieke output'. Computercode valt onder een andere definitie van 'code': 'een systeem van het gebruik van abstracte symbolen om een ​​bericht via een medium door te geven'. IDCers houden ervan om dubbelzinnig te zijn over de twee definities.

Computercode wordt gebruikt als een analogie voor de DNA-functie, maar zoals alle analogieën valt het uiteen als het nauwkeurig wordt onderzocht. In de fundamentele mechanica werken de twee totaal anders. Computercode gebruikt abstracte symbolen om informatie door te geven aan de machine die het werk doet. De symbolen zijn onafhankelijk van het medium en moeten op een ander moment worden geïnterpreteerd om bewerkingen uit te voeren. DNA daarentegen is helemaal niet abstract. Het is een fysiek molecuul dat deel uitmaakt van een zichzelf in stand houdende chemische reactie (toegegeven een verbazingwekkend gecompliceerde). Een reactie die alleen de wetten van scheikunde en natuurkunde volgt om door te gaan. Het is volledig afhankelijk van zijn fysieke structuur. Een DNA-model gemaakt van stokken en klei en codeert niet voor een eiwit, hoe hard je ook bidt.
====

Dit is waar evolutie over gaat. Met net genoeg kennis om gevaarlijk te zijn, moet het verplicht stellen van hun theorie een feit zijn omdat hun religie het eist, hun religie in hun wetenschap te injecteren, anderen ervan te beschuldigen precies dat te doen terwijl ze zoiets nooit hebben gedaan, enorme problemen negerend, de vraag belachelijk makend, en als ze een antwoord geven, wordt het probleem niet aangepakt. In dit geval roept het eenvoudig nog diepere problemen op.

Een wezenlijk verschil tussen biologie en techniek is dat in de biologie de feedbacklussen, signalen, informatie, enzovoort, een groot deel van de plant uitmaken. Dit maakt het veel complexer, iets wat evolutionisten als vanzelfsprekend lijken te beschouwen zonder een idee te hebben.

Religieuze zekerheid gebaseerd op onwetendheid, gekoppeld aan hypocrisie en demonisering. Het klinkt als een ongelooflijke overdrijving, maar je hoeft alleen maar de literatuur (of de commentaren) te lezen.

"In plaats van dat "primitieve genomen werden georganiseerd met oorsprong en promotors in dezelfde oriëntatie", zou ik ze vanaf het begin willekeurig hebben georiënteerd, waarbij ik elke suggestie van teleologie of ontwerp zou vermijden, en in overeenstemming met het evolutionaire thema van willekeur. "

Vat samen waarom ID (als wetenschap) gedoemd is - het begon met een vooraf vervalst uitgangspunt:

Alles wat niet willekeurig is, is teleologisch!

De genetische variatie die de evolutie ingaat, is het product van willekeurige processen, maar selectie levert allesbehalve willekeurige resultaten op. Neem mijn hypothetische voorbeeld: als oude replicators genen in de verkeerde richting aan elkaar koppelden, zijn ze gedoemd te mislukken. Dus een eenvoudig selectief proces kan een resultaat opleveren waarbij alle genpromotors in dezelfde richting worden geordend. We zien de overblijfselen van dit systeem vandaag. Deze organisatie LIJKT ontworpen naar Cornelius, en hij schreeuwt meteen ontwerper, maar is gewoon het product van noodzaak.

Als we naar minder hypothetische voorbeelden gaan, weten we in gerichte evolutie, genetische algoritmen en directe observaties dat informatie in evolutie kan toenemen.

Totdat je dit punt grondig weerlegt, heb je interessante maar irrelevante observaties.

En het argument dat evolutionaire biologie niet elk detail van elk laatste systeem heeft opgelost, pleit niet voor ID als vervanging. Het is een bewijs van het succes dat je moet blijven overstappen naar kleinere en kleinere systemen, en meer recente ontdekkingen om te vinden wat de wetenschap nog niet weet/

Ik geef hierboven een pad om de evolutie van dit systeem te bestuderen. Welk ID-gebaseerd pad zou je nemen om het te begrijpen? Oh, juist, die is er niet, omdat je het antwoord aan het begin veronderstelt. Zelfs je dwaze tegenvoorbeeld veronderstelt evolutie.

“Religieuze zekerheid gebaseerd op onwetendheid, gekoppeld aan hypocrisie en demonisering. Het klinkt als een ongelooflijke overdrijving, maar je hoeft alleen maar de literatuur (of de commentaren) te lezen."

Oh, en gewoon voor de lol, wat functiewinst door selectie op willekeurige invoer. Ja, de empirische vervalsing van ID:

Trouwens, dit zijn natuurlijke gain-of-function-mutaties:

Oké, dus dat is allemaal natuurlijk, maar hier is een cool gestuurd experiment van het evolutietype - willekeurig domein shuffelen levert nieuwe interessante fenotypes op na selectie:

Snelle diversificatie van celsignaleringsfenotypes door modulaire domeinrecombinatie.
Peisajovich SG, Garbarino Science. 2010 april 16328(5976):368-72.JE, Wei P, Lim WA.

Als je geïnteresseerd bent, google dan eens op 'directed evolution' voor nog veel meer in deze richting - waar de mens willekeurige variatie + selectie heeft gemaakt - > nieuwe functie.

'Informatie' zo u wilt.

& quot. wat nodig is, is een plausibele verklaring.' Nee, wat nodig is, is de wetenschappelijke methode die wordt toegepast op de evolutietheorie. Een wetenschappelijke methode bestaat uit het verzamelen van gegevens door middel van observatie en experimenten, en het formuleren en testen van hypothesen. "Plausibele verklaring" is geen wetenschap tenzij ondersteund door een wetenschappelijke methode. Door een "plausibele verklaring" te accepteren leg je de lat zo laag dat evolutie geloofwaardig wordt.

Cornelius: "Dit is waar evolutie over gaat. Met net genoeg kennis om gevaarlijk te zijn, moet het verplicht stellen van hun theorie een feit zijn omdat hun religie het eist, hun religie in hun wetenschap te injecteren, anderen ervan te beschuldigen precies dat te doen terwijl ze zoiets nooit hebben gedaan, enorme problemen negerend, de vraag belachelijk makend, en als ze een antwoord geven, wordt het probleem niet aangepakt. In dit geval roept het eenvoudig nog diepere problemen op.

Een wezenlijk verschil tussen biologie en techniek is dat in de biologie de feedbacklussen, signalen, informatie, enzovoort, een groot deel van de plant uitmaken. Dit maakt het veel complexer, iets wat evolutionisten als vanzelfsprekend lijken te beschouwen zonder een idee te hebben.

Religieuze zekerheid gebaseerd op onwetendheid, gekoppeld aan hypocrisie en demonisering. Het klinkt als een ongelooflijke overdrijving, maar je hoeft alleen maar de literatuur (of de commentaren) te lezen."

LOL! CH, ik zie dat je dezelfde vermoeide, oude creationistische canards uitdraafde die we allemaal al jaren horen, maar ging niet in op een enkel punt Ik verhoogde in een van mijn berichten.

Gewoon weer een epische FAIL voor de wetenschapsvrije IDC'ers.

Een van die bedrieglijke wegversperringen is dat het plaatsen van dergelijk bewijs in de min-kolom neerkomt op een argument uit ongeloof. “Je kunt je niet voorstellen hoe evolutie zo'n ontwerp zou kunnen hebben gemaakt,' zeggen evolutionisten, 'en dus denken jullie dat het bewijs is tegen evolutie.'8221

En toch gaat dezelfde evolutionist die dit argument gebruikt verder met ons te vertellen dat evolutie waar moet zijn, omdat God de dingen niet zou hebben geschapen zoals ze zijn. Dus ze kunnen het argument van ongeloof gebruiken tegen het bestaan ​​van een schepper, maar wij kunnen niet hetzelfde argument gebruiken tegen de levensvatbaarheid van evolutie?

Ik denk dat ik hier een dubbele standaard ruik.

Ik heb enkele antwoorden op mijn opmerkingen gelezen. Het lijkt erop dat voor darwinisten Evolutie de wetenschappelijke methode IS. Wanneer er waarnemingen worden gedaan in andere wetenschappen die een bepaald aspect van de darwinistische theorie tegenspreken, doen darwinisten het snel af als "Oh, maar omdat het geen biologie is, telt het niet." Evolutie zit op haar eigen eilandje, onaantastbaar voor andere wetenschappen.

Ook lijken darwinisten moeite te hebben met het begrijpen van eenvoudige argumenten. Dus ik moet begrijpen dat DNA niet is als computercode, omdat ze fysiek heel anders zijn? En dan? Dat weet ik al! Niemand maakt een argument dat ze fysiek identiek zijn. Als we zeggen dat DNA is als computercode, verwijzen we naar hun INFORMATIEVE eigenschappen. En de INFORMATIEVE EIGENSCHAPPEN zijn identiek, voor zover structuur, maar ook als een NIET-FYSIEKE, ABSTRACTE EIGENSCHAP. Chemie KAN NIET UITLEGGEN welke informatie nodig is om een ​​zelfreplicerende cyclus te produceren, want fysiek is er niets geordend in informatie, het is volledig onregelmatig. Informatie is belangrijk, omdat het onregelmatig is en gespecificeerd is, een hoogst onwaarschijnlijke combinatie. Het probleem met darwinisten is dat ze onwetend zijn: ze bestuderen alleen het darwinisme en weten niets van wat andere wetenschappelijke gebieden erover te zeggen hebben.

En dan is er nog het argument dat ik, als leek, onmogelijk genoeg kon weten om de complexiteit van de darwinistische theorie te begrijpen. Nou, raad eens, Darwins theorie is even simpel als dom. En ik ZAL "wetenschappers" ondervragen die zomaar-zo-verhalen eruit flappen als geldige wetenschappelijke theorieën, die niet in staat zijn om identiteitsbewijs nauwkeurig weer te geven voordat het "weerleggen" is, en die zichzelf opwerpen als "DE HEROIC VERDEDIGERS VAN DE WETENSCHAP", terwijl ze een oogje dichtknijpen voor de frauduleuze bewijzen dat wordt aan schoolkinderen gepresenteerd als bewijs voor het darwinisme. zoals de Embryo-tekeningen van Heacle. (Dit is al meer dan 100 jaar bekend.) Grappig ook hoe darwinisten volhouden dat "theorieën voorspellingen moeten doen" en hoe elke voorspelling die het darwinisme heeft gedaan VOOR HET FEIT onjuist is gebleken: van het "eenvoudige protoplasma-idee van de cel" in de tijd van Darwin , tot Eugenetica, tot Junk-DNA, tot Evolutionaire fycologie die zegt dat zelfbewustzijn een illusie is. Je moet zelfbewustzijn hebben om ergens een illusie van te hebben, dus hoe kan zelfbewustzijn zelf een illusie zijn? Dus leven is slechts een illusie, waar het eigenlijk net zo dood is als mijn laptop. I know of no other scientific fields where scienitists are so often "surprised" by new discoveries as in Darwinism. Maybe that says something about your paradigm!

ID has made a strong case, using empirical evidence, and combining various scientific dissiplines, while Darwinists only reinforce their case by destroying their own reputations with pathetic "refutations". You have a better chance to see a blind man hit a bulls eye, than to see a Darwinist making a case against what ID ACTUALLY states, rather than against their own imagination.

"And yet the same evolutionist who uses this argument then proceeds to tell us that evolution must be true because God wouldn't have created things the way they are. So they can use the argument of incredulity against the existence of a creator but we can't use the same argument against the viability of evolution?

Me thinks I smell a double standard here."

When we say there is no natural process in the known universe that can produce specified irregularity, apart from ID, they say it's an argument from ignorance. But they themselves have no problem with using vestigial structures as evidence for evolution. Yet, just because we don't know why something is constructed a certain way, does not necessarily mean that it is evolutionary junk. Remember junk DNA? Arguments from ignorance are used all the time to defend evolution.

Then there is the claim that Irreducible Complexity is unfalsifiable. I will grant the Darwinists this one, it is a bit fuzzy, and it is easy to circumvent with the creative imagination of Darwinists. But Darwin wrote Evolution can be falsified by showing that structures exists which could not possibly be formed in a slow and gradual process, in other words, that IC exists. If IC is unfalsifiable, then so is Darwinism, because IC is the criteria with which to falsify Darwinism.

"Computer code is used as an analogy for DNA function, but like all analogies it breaks down when examined closely. In the fundamental mechanics the two operate completely differently. Computer code uses abstract symbols to pass information to the machine doing the work. The symbols are independent of the medium and needs to be interpreted at a different time in order to perform operations. DNA on the other hand is not abstract at all. It is a physical molecule that is part of a self- sustaining chemical reaction (granted an amazingly complicated one). A reaction that merely follows the laws of chemistry and physics to proceed. It is completely dependent on its physical structure. A model of DNA created out of sticks and clay and won't code for a protein no matter how hard you pray.

I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid. In fact, the code does differ in some species.

Also, the DNA specifications get translated into an amino acid string that just happen to fold into a workable protein. There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question. Yes, chemistry dictate what DNA looks like, and chemistry control the translation of DNA, but it DOES NOT explain why DNA the translated molecule from DNA should have any meaningful function at all. In fact, without this information, you can not even build the molecules that does the translation, as they themselves are incoded into the DNA.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

"I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The fact that the genetic code is *not* universal, the fact that there is no chemical necessity that *this* codon triplet translate to *that* amino acid shows that the DNA medium is not the message.

But, of course, one knows better than to ever expect the DarwinDefenders to admit to such a truth.

There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question.

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic
Code

I am particularly struck by the difficulty of getting [the genetic code] started unless there is some basis in the specificity of interaction between nucleic acids and amino acids or polypeptide to build upon. (Woese 1967)

Nonetheless, it is clear that at some early stage in the evolution of life the direct association of amino acids with polynucleotides, which was later to evolve into the genetic code, must have begun. (Orgel 1968)

Part I: The Observed Mechanism of RNA–Amino Acid
Interaction

Just above, Carl Woese and Leslie Orgel, writing at the dawn of molecular biology and coding, suppose that chemical interactions between nucleotide sequences and amino acids are an indispensable basis for the genetic code. It is the conclusion of the present narrative that such interactions are easily demonstrated, utilize plausible, simple chemistry, and can indeed be shown to echo part of the genetic code.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

Abstraction is a mental activity. Don’t confuse pattern recognition by the human mind for the operation of stereochemical processes :: Don’t confuse the map with the territory.

Hanno: "The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid."

LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

The human description of the reaction uses abstract symbols, but not the reaction itself. HUGE difference.

Here's an experiment you can do Hanno. Trot on down to your local ID lab. Build a replica tRNA molecule from Tinkertoys. See how long it takes that molecule to create a Tinkertoy amino acid. Get back to us with the results.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water
.
SO3 + H2O --> H2SO4
.
is abstract.
"

These people are fools it's not that they're ignorant, it's not that they're stupid, it's that they are intellectually dishonest. It's that they intentionally assert falsehoods and intentionally engage in faulty reasoning . all in a hopeless effort to protect Darwinism (and atheism) from rational scrutiny.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

You are either ignorant of how DNA translate into amino acid strings, or you are dishonest.

There is no chemical reason why one DNA base pair should be followed by another particular base pair. In fact, if there were, DNA would've been a crystal, unable to carry any information. Its message would be reduced to something like ATGCATGCATGCATGC.

The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code. Seen from a purely physical perspective, the base pairs are irregular and chaotic. It is the abstract meaning of the code that makes it significant. Information is recognized when there's specification, without any physical attachment with the object being specified. Nature does not create specifications, it simply follows laws of physics wherever they lead. Specification is always a product of mind.

No one is arguing the physical mechanism to read and interpret the data. Computers read their data via physical processes as well. Without it, the data would be meaningless. No one is disputing the physical processes involved in reading the data. That is not the issue, the issue is the data itself.

"You are either ignorant of how DNA translate into amino acid strings, or you are dishonest."

A DarwinDefender will do or say just about anything, including emulating a stultifying and irreversible ignorance, in order to keep from seeing that not only is his evolutionism false, but that it can't even be true.

Hanno: "The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code."

That's just plain stupid. Maybe you should go look up the definition of 'abstract' and 'abstract symbol' before you stick that other foot in your mouth.

BTW, how's that experiment with the Tinkertoys coming? Have the 'abstract' toy molecules produced any amino acids yet?

Specification is always a product of mind.

There is no chemical reason why one DNA base pair should be followed by another particular base pair.

Did you read the reference I gave you?

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic Code

There's plenty of reason, apparently.

Hanno: "Specification is always a product of mind."

Vertaling: "Make me admit the self-evident truth that I *will not* admit."

That's OK, he can still prove it. Or you might try.

abstract or an abstraction?

If the former, did a "mind" design it?

"In the 1880s, Rydberg worked on a formula describing the relation between the wavelengths in spectral lines of alkali metals"

Ofcause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

The formula itself has no physical relationship with the thing it describes, and yet it specifies it.

Also, isn't always Darwinists who complain that you "can't proof a negative?". Specification IS ALWAYS the product of mind, and we know this from everyday experience. If you feel that undirected natural processes are capable of producing specification, then the burden of proof is on you.

Lastly, I admin I have not read your article. I have very limited time, and I'm growing quite weary of Darwinists who constantly waste my time by referring me to articles that simply assumes evolution occurred, and then back it up with just so stories. I don't know what exactly that is suppose to prove. I do not refer you to Signature of the Cell. Though it would be great if you could read it yourself, I know you are probably to biased to bother, so I describe the argument as best I can in a post short enough for you to read.

Rather than bombarding me with links (Which I noticed is a favorite tactic of Darwinists) Why don't you just give me a summarized version of the argument, and if it isn't just another case of "We know evolution has occurred, so maybe this is how it could've happened", I'll read it. At least show me that you've read and understood the argument yourself, by explaining it in your own words, before referring me there. Otherwise, we might just as well stop talking to each other, and just start posting links.

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

As impressive as this all seems, I have only one question, one which David Berlinski has asked as well: "Can the results of Powner et al be reproduced without Powner et al?" - or in this case "Can the results of Yarus et al be reproduced without Yarus et al?"

All these abiogenesis experiments achieve is to underline how critical intelligent interference is in order to produce these molecules. Without an intelligent agent that filter out impurities, protect the molecule from degradation, and guide the molecule's development by playing the role of selection (selection for future advantage, I might add, which is basically what design is), all the abiogenesis scenario's fall apart.

Oh no? So what PHYSICAL property DOES dictate the sequence of DNA nucleotides? Enlighten me.

BTW, I don't exactly know what your point is with the tinker toys. No one ever argued that chemistry played no role in biochemistry. That would just be stupid.

Of cause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

Hanno, thanks for your comment, but you seem to be contradicting yourself. What mind designed the Rydberg formula? God's or Rydberg's? When ID persons use the word "design" referring to biology, it means "create." And then you say the formula does not describe the "actual" relation between the wavelengths, but it yet describes the relation between them. What is the function of the word "actual" in your sentence?

Who did the specifying in this specification? God or Rydberg?

By the same token, who specified the "actual" genetic code, chemical evolution, God, or human beings? Can you see that the code is a description conceived by humans of chemical processes that developed naturally, just as Rydberg's formula is a description of physical properties that matter displays?

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

Granted, the paper is technical, but since it refutes your reiterated claim that the genetic code has no chemical basis, you might at least have said something about it.

Surely the excerpt from the introduction that I posted earlier would have explained the issue well enough.

At some point, doesn't a science skeptic need to understand the science?

Regarding your first post, you seem to be making a category mistake.

The formula describing some feature in nature is distinct from nature itself. All formula's are derived from mind. E=mc2 is the formula and is a product of Einstein's mind. The atom bomb is physical effect. The formula IS NOT the natural effect, it DESCRIBES the natural effect. The particles themselves only react to chemical and nuclear forces, while the formula describes how they react. Formula's are forms of information, and like all information, it is the product of mind.

Likewise, there is no chemical necessity that DNA code should specify functioning proteins. You can mix the DNA code in any order you want, and, thanks to the machinery of the cell, is will produce a amino acid string, but that string will not necessarily fold into a stable protein. The SEQUENCE of DNA nucleotides constitute information, as it has no physical relation to the final product.

Secondly, regarding your paper, I will have to admit that you have me at a disadvantage. I did admit to being a layman in science, which means that I have SOME scientific knowledge, but not enough to comment on a highly technical paper. However, I do not think this disqualifies my position out of hand.

Firstly, there ARE ID scientists that DO understand these technical papers, and who are NOT convinced. (Scientists with all kinds of different religious backgrounds) According to them, all these papers assume evolution occurred, rather than concluding it. All abiogenesis experiments involve some form of human intervention, and always simulates conditions in a idealistic way rather than a realistic one. If abiogenesis is possible, one would expect a scientist to be able to set up the initial (realistic) conditions, and then sit back to see chemistry do its thing.

Secondly, ID Scientists make very strong arguments based on empirical evidence. One hardly ever see a calm reasoned response from Darwinists, rather it their replies involve name calling, and misrepresentations of the argument itself. If Darwinism is true, why can't they just answer the question, rather than avoiding it?

Thirdly, while Darwinists appear VERY concerned about the effect ID would have on science, one hardly ever hear any concern from them about inaccuracies on the Darwinian side. To the contrary, if you point them out, you're a "creationist".

Fourthly, there is a very clear double standard applied between ID and Darwinism. For Darwinism, just so stories are acceptable theories, while no amount of empirical evidence and reasoning seems to be enough for ID.

If ID made anything clear, it is that the Darwinian scientists are *NOT* honest in their motivations, and *DOES* exclude certain possibilities for purely philosophical reasons. Under these conditions, I feel perfectly comfortable attacking Darwinian theory.

Also, in Signature of the Cell, Stephen C Meyer outline his own study of the various theories on origin of live since Darwin to the RNA world. All these theories treat the origin of live as a purely chemical problem and either ignores or displaces the problem of informational origin. Though I can not do so myself, ID scientists like Meyer can understand your paper, and will criticize it. Moreover, I have a general idea of what his criticism would be: most probably displacing the origin of information out of view, rather than explaining it.

Now, I'm completely open to an explanation on how undirected natural processes can form information. I'm also not afraid of technical terms, as long as I can find an explanation for them. But to shoot above my head and then to call it quits is not fair play. Lacking knowledge is not the same as being stupid.


Invoering

The cell, with its variety of cellular compartments, varying polarities, competing interactions, and differing sites of molecular synthesis poses challenges to the formation of biomolecular interactions essential to all biological processes. This necessitates ways to bring biomolecules together in a tightly regulated manner. One mechanism for this localization is the use of molecular scaffolds to enable particular interactions while inhibiting off-pathway interactions, thus increasing the efficiencies of the biological processes in which they are involved in Zappulla and Cech (2006). Whereas proteins have long been appreciated to sometimes function as scaffolds, it is becoming increasingly clear that RNA molecules can also facilitate a wide range of interactions among and between proteins and nucleic acids, in many cellular contexts.

In this review, we define an “RNA scaffold” as an RNA molecule capable of bringing together 2 or more macromolecules to form a complex with functional activity. These macromolecules may be proteins, other RNAs or DNA molecules that in the absence of the RNA scaffold do not interact or do so very poorly. By this definition, perhaps the most well-known RNA scaffold molecules are ribosomal RNAs (rRNAs), which provide the structural and catalytic core of ribosomes around which approximately 57� ribosomal proteins (depending on species) (Lecompte et al., 2002) assemble to generate functioning ribosomes. Beyond this, long non-coding RNAs (lncRNAs) and even messenger RNAs (mRNAs) are now increasingly being shown to perform a diverse array of scaffolding roles. While rRNAs, bound by ribosomal proteins, are generally regarded as mostly static ribonucleoprotein complexes (RNPs) (Mathis et al., 2017)- although study of “specialized ribosomes” may shift this view (Genuth and Barna, 2018) – lncRNA and mRNAs are generally thought to facilitate more transient, regulatable interactions. Thus, RNAs can scaffold both stable cellular complexes and facilitate transient macromolecular interactions.

RNA can also function as a �oy” molecule, which we define similarly to a scaffold, except that in this case, two or more macromolecules are brought together by the RNA decoy in a complex that prevents the sequestered macromolecules from forming other interactions and functional complexes at other cellular locations. As with scaffolds, RNA decoy interactions can be transient and regulatable.

RNAs as molecular scaffolds or decoys possess several advantages over other types of biomolecules like proteins and DNA, including: (1) RNAs fold more readily than DNA into complex 3D structures by virtue of diverse secondary and tertiary structural interactions. (2) RNA abundance can be easily and rapidly increased (new transcription) or decreased (RNA decay) while using 1𠄲 orders of magnitude less energy than occurs for similar regulation of protein (Lynch and Marinov, 2015) indeed translation is the most energy-intensive process in a cell (Topisirovic and Sonenberg, 2011), whereas transcription (barring initiation) is largely an ATP-independent process (Imashimizu et al., 2014). (3) Unlike DNA, RNA is unencumbered with serving as a cell’s nuclear-localized permanent genetic material, thus increasing RNA’s regulatory potential. (4) Compared to proteins, RNA binds other molecules much more efficiently. For instance, 4� nts of RNA are capable of binding specific proteins, whereas protein-protein interaction domains typically range from tens to hundreds of amino acids (Prikryl et al., 2011 Chujo et al., 2016 Lunde et al., 2017). Additionally, RNA molecules are generally longer than most proteins (typical size of a globular protein = 5 nm radius of gyration of mRNA = 16.8�.8 nm) allowing greater spatial interaction potential with other biomolecules. (5) Evolution of RNA scaffolding functions likely occurs faster and is under less constraint than with protein scaffolds. This is evidenced by lower conservation of lncRNA genes versus protein coding genes (Johnsson et al., 2014), and the more complex protein folding rules and solubility issues that proteins face given their complement of 20 + distinct amino acids.

In this review, we discuss examples of many nuclear and cytoplasmic RNA scaffolds and decoys, some of which regulate relatively stable complexes, while others facilitate transient macromolecular interactions. Concepts of RNA-driven assemblies that have emerged, their physiological importance, and key remaining questions for future study will be highlighted. We will also focus on recent findings of mRNAs acting as cytoplasmic RNA scaffolds, and other means by which nascently translated proteins find their interaction partners. Finally, we discuss steps that can be taken to identify new RNA scaffolds and decoys.


Transcription/Translation Questions

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figuur 1

A (the little circle): amino zuur

B (the whole molecule): tRNA

C (this specific component of the molecule): anticodon

D (three at a time): complimentary codon to anticodon

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Eiwitten

Is the 5′ cap on the right or left hand side of the mRNA molecule above? linkerkant

This is a diagram of what cellular process?
It is a diagram of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUGCCG 3’ , was built from the correct template strand of DNA, 3’ TACGGC 5’ . What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ ATGCCG 3’ , instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site?

In the A site, tRNA accepts amino acids passed from the P site. P site passes the amino acids to A sites.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

It would be TTA and it would be carrying N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5’_______3′.

7) If the sjabloon streng of DNA had the sequence 3′ ATGGGC 5′ , the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′ AUGGGC 3′ , UAC CCG
  2. 5′ AUGGGC 3′ , AUG GGC
  3. 5′ UACCCG 3′ , UAC CCG
  4. 5′ UACCCG 3′ , AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucine
  2. glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

Multiple ribosomes traveling at one strand of mRNA is needed because the tRNA filters the ribosome randomly which makes the process untimely. The process is vital in order to make proteins in a timely manner because of the copy of mRNA.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

I think because mRNA is a copy.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figuur 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap C
  2. Introns NS
  3. Exons EEN
  4. poly-A staart B

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins?

Introns are the ones required and exons are the ones that are not needed during translation. One gene can code for multiple proteins by making different combinations every time.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’ TGCAATATT CGATGTCACCGCTCGAGAAC GACATCGATTAAC CATATTCG 3′ * 3’ ACGTTATAAGC|TAC|AGT|GGC|GAG|CTC|TTG|CTG|TAG|CTA|ATT|GGT|ATA|AGC 5’

mRNA: 5′ AUG UCA CUC GAG AAC GAC AUC GAU UAA 3′


Classwork and Homework 2/9

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figuur 1

A (the little circle): Amino Acid

B (the whole molecule): tRNA

C (this specific component of the molecule): Anti codons

D (three at a time): Codons complimentary to anti codons

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Protein Chain

Is the 5′ cap on the right or left hand side of the mRNA molecule above? Left side

This is a diagram of what cellular process? This diagram is portraying the process of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUG CCG 3’, was built from the correct template strand of DNA, 3’TAC GGC 5’. What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ATG CCG 3’, instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site? At the A site the tRNA molecule accepts the amino acid passed from the P site. At the P site of the ribosome the amino accept from the tRNA is passed to the A site.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

The anticodon of the next tRNA molecule would be TTA, it would be carrying the amino acid N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5′-3’______.

7) If the sjabloon streng of DNA had the sequence 3′ATG GGC 5′, the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′AUGGGC3′, UAC CCG
  2. 5′AUGGGC3′, AUG GGC
  3. 5′UAC CCG3′, UAC CCG
  4. 5′ UAC CCG3′, AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucine
  2. glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

The process of multiple ribosomes traveling over one strand of mRNA is necessary because the fact that tRNA filters through the ribosome at random making the process untimely. Multiple ribosomes also allow the multiple proteins to made a the same time greater using the single mRNA copy strand.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

The mutations of a mRNA strand are less dire than a DNA molecule because a DNA molecule makes numerous and all copies for proteins spreading the mutation, rather than the mRNA which is only used a few times then terminated.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figuur 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap _C____
  2. Introns_ NS____
  3. Exons_ EEN____
  4. poly-A tail__ B___

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins? Introns are the unnecessary gene material in mRNA, there are removed from mRNA before translation. Exons are the usable and necessary genes which are used to code for proteins. One gene code can code for multiple proteins as different combinations of genes result in different proteins and protein chains.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’TGCAATATT CGATGTCACCGCTCGAGAACGACATCGATTAAC CATATTCG3′ *3’ACGTTATAAGC TAC AGT GGC GAG CTC TTG CTG TAG CTA ATT GGTATAAGC5’


Darwins God

If you had a four-letter alphabet and all words were three letters, then how many words would there be? The answer is 4 times 4 times 4, or 4-cubed, or 4^3, or 64. That’s how the DNA code works. Our DNA has four molecular “letters” and to create a protein the letters are taken three at a time in words called “codons.” Each codon specifies an amino acid and these 64 different codons are mapped to 20 different amino acids (and a “stop” signal). Since the 64 different codons far exceeds the 20 different amino acids and the stop signal, the code is degenerate. In other words, there are multiple codons that map the same amino acid (just as “absurd” and “ludicrous” have similar meanings).

But why the mismatch? If only 20 different amino acids are coded for, why are there 64 different codons? There is quite a bit of unused messaging power, or what engineers call “bandwidth.” According to evolutionists, it was just another biological kludge revealing nature’s dysteleology.

But ever since its discovery the DNA code has continued to yield hidden treasures of intricacy. For example, the code is cleverly designed at several levels, including minimizing the effects of errors and maximizing information content (such as in supporting overlapping messages).

This makes it even more difficult for evolutionists to explain how the code evolved.

Furthermore the code’s unused bandwidth has been found to be used in a variety of creative ways where additional information is layered on the basic message indicating the amino acid sequence. You can see some examples here, here, here and here.

The new UCSF paper is another such an example of yet another layer of information in the “unused” bandwidth that evolutionists thought was just an inefficient fluke. It has been known for years that a DNA gene, that is used to construct a protein, has some special signals near the beginning that will help the translating process get started correctly.

Now, the new research indicates that similar signals are used throughout the gene. Their purpose is not to help the protein production process get started correctly, but rather to fine-tune the speed of the production process.

It is yet another example of the many different types of information that are layered in a DNA gene which have evolutionists rewriting their script and explaining that “It’s over. None of that happened.”

99 comments:

God must have loved bacteria. He gave them Shine-Dalgarno sequences.

Notes of related interest: It is found that the first DNA code had to be at least as complex as the current DNA code found in life:

Shannon Information - Channel Capacity - Perry Marshall - video
http://www.metacafe.com/watch/5457552/

“Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
Donald E. Johnson – Bioinformatics: The Information in Life

Yet despite this severe constraint on evolability, it is found that DNA is a 'optimal code'

Biophysicist Hubert Yockey determined that natural selection would have to explore 1.40 x 10^70 different genetic codes to discover the optimal universal genetic code that is found in nature. The maximum amount of time available for it to originate is 6.3 x 10^15 seconds. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that is optimal. Put simply, natural selection lacks the time necessary to find the optimal universal genetic code we find in nature. (Fazale Rana, -The Cell's Design - 2008 - page 177)

“The genetic code’s error-minimization properties are far more dramatic than these (one in a million) results indicate. When the researchers calculated the error-minimization capacity of the one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution. Researchers estimate the existence of 10^18 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This means of 10^18 codes few, if any have an error-minimization capacity that approaches the code found universally throughout nature.”
Fazale Rana - From page 175 'The Cell’s Design'
http://www.reasons.org/biology/biochemical-design/fyi-id-dna-deciphering-design-genetic-code

As well there was a ‘optimality’ found for the 20 amino acid set used in the 'standard' Genetic code when the set was compared to 1 million randomly generated alternative amino acid sets

Does Life Use a Non-Random Set of Amino Acids? - Jonathan M. - April 2011
Excerpt: The authors compared the coverage of the standard alphabet of 20 amino acids for size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates. De resultaten? The authors noted that: "…the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof."
http://www.evolutionnews.org/2011/04/does_life_use_a_non-random_set045661.html

Extreme genetic code optimality from a molecular dynamics calculation of amino acid polar requirement – 2009
Excerpt: A molecular dynamics calculation of the amino acid polar requirement is used to score the canonical genetic code. Monte Carlo simulation shows that this computational polar requirement has been optimized by the canonical genetic code, an order of magnitude more than any previously known measure, effectively ruling out a vertical evolution dynamics.
http://pre.aps.org/abstract/PRE/v79/i6/e060901

Collective evolution and the genetic code - 2006:
Excerpt: The genetic code could well be optimized to a greater extent than anything else in biology and yet is generally regarded as the biological element least capable of evolving.
http://www.pnas.org/content/103/28/10696.full

Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes. the present findings support the view that protein-coding regions can carry abundant parallel codes.
http://genome.cshlp.org/content/17/4/405.full

The data compression of some stretches of human DNA is estimated to be up to 12 codes thick (12 different ways of DNA transcription) (Trifonov, 1989). (This is well beyond the complexity of any computer code ever written by man). John Sanford - Genetic Entropy

The multiple codes of nucleotide sequences. Trifonov EN. - 1989
Excerpt: Nucleotide sequences carry genetic information of many different kinds, not just instructions for protein synthesis (triplet code).
http://www.ncbi.nlm.nih.gov/pubmed/2673451

"In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
Donald E. Johnson – Programming of Life – pg.51 - 2010

As well, DNA coding is optimized for energy efficiency

DNA coding is apparently successfully designed along the very stringent guidelines laid out by Landauer's principle of 'reversible computation' in order to achieve such amazing energy efficiency, something man has yet to accomplish in any meaningful way for computers:


Bekijk de video: SINTESIS PROTEIN. TRANSKRIPSI DAN TRANSLASI. BIOLOGI KELAS 12. SEMESTER 1. BIOLOGI EDUKASI (Augustus 2022).