Informatie

PCR-amplificatie krijgen bij uitgloeien hoger dan Tm!

PCR-amplificatie krijgen bij uitgloeien hoger dan Tm!



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ik amplificeer een gen waarbij ik in een gradiënt-pcr amplificatie krijg bij een uitgloeitemperatuur van ongeveer 5 graden (67) hoger dan Tm (62,5)? Wat is hier mis? Ik krijg ook een zeer sterke intense band met de verkeerde maat voor alle temperaturen die onder Tm zijn geprobeerd. Pls help


Het is heel gebruikelijk om uitgloeien te krijgen bij een hogere dan voorspelde Tm. Als het in jouw geval een probleem is, vooral als je verkeerde annealing krijgt bij lagere temperaturen, overweeg dan om touchdown-PCR te gebruiken om een ​​optimale temperatuur te vinden. Of, pragmatisch, als u enige flexibiliteit heeft bij het ontwerpen van primers, bestelt u gewoon een set primers en probeert u ze allemaal. Primers zijn tegenwoordig goedkoop en je zult vaak een set vinden die werkt, zelfs als de ontwerpprogramma's beweren dat ze dat niet zullen doen.


Tm van primers zou niet veel zeggen over PCR-omstandigheden. Als u niet-specifieke banden krijgt, is het de moeite waard om een ​​hogere temperatuur te proberen.

Je temp probeert al dicht bij de temp te verlengen, zodat shuttle PCR beschikbaar is. Shuttle PCR heeft slechts 2 stappen: 94 tot 96 graden voor het smelten van DNA en 68 tot 74 graden voor annealing en extensie samen.

Misschien wilt u DMSO of betatain toevoegen. Ze kunnen helpen om mis-annealing te verminderen. Als de niet-specifieke banden kleiner en langer zijn dan de banden die u verwacht, kunnen langere en kortere verlengingstijden u respectievelijk betere resultaten geven.

En onthoud dat het ontwerp van de primer ook belangrijk is. Controleer of u sequenties in uw sjabloon hebt die zich herhalen en vermijd het ontwerpen van primers van dergelijke sequenties.


Wat betreft een hogere gloeitemperatuur dan Tm, gebruik ik vaak T7-primer waarvan de Tm 48,3 graden is. De primer werkt goed bij 55 graden gloeitemperatuur. Gewoonlijk zijn primers in overmaat in PCR-reactiebuizen, waardoor het chemische evenwicht in de richting van uitgloeien wordt geduwd. Dat is wat ik speculeer.


De TM van de primer wordt ook beïnvloed door de zoutconcentratie van je mix. Probeer je de PCR-gradiënt? Of je probeert de berekening van Tm en houdt rekening met de zoutconcentratie. http://www.biophp.org/minitools/melting_temperature/demo.php


Touchdown PCR: een inleiding en enkele tips

Toen ik voor het eerst hoorde van touchdown-PCR, dacht ik aan een landend vliegtuig, wat, zo blijkt, geen slechte manier is om erover na te denken.

Maar ondanks de vatbaarheid voor analogieën en vreselijke woordspelingen (zie titel), is touch-down PCR (TD-PCR), een zeer bruikbare techniek voor het verbeteren van de specificiteit van PCR-amplificatie, lastiger dan het op het eerste gezicht lijkt. Dus in dit artikel zal ik een inleiding geven over touchdown PCR (TD-PCR) en enkele tips en referenties om het te perfectioneren.


QPCR en RT-qPCR

Kwantitatieve eindpunt-PCR

PCR en RT-PCR worden over het algemeen gebruikt in een kwalitatief formaat om biologische monsters te evalueren. Een breed scala aan toepassingen, zoals het bepalen van de virale belasting, het meten van reacties op therapeutische middelen en het karakteriseren van genexpressie, zou echter worden verbeterd door kwantitatieve bepaling van de hoeveelheid doelwitten. Theoretisch zou dit, gezien de exponentiële aard van PCR, eenvoudig te realiseren moeten zijn, omdat er een lineair verband bestaat tussen het aantal amplificatiecycli en de logaritme van het aantal moleculen. In de praktijk neemt de efficiëntie van de amplificatie echter af vanwege contaminanten (remmers), competitieve reacties, substraatuitputting, polymerase-inactivatie en heraanhechting van het doelwit. Naarmate het aantal cycli toeneemt, neemt de efficiëntie van de amplificatie af, wat uiteindelijk resulteert in een plateau-effect.

Normaal gesproken vereist kwantitatieve PCR dat metingen worden gedaan vóór de plateaufase, zodat de relatie tussen het aantal cycli en moleculen relatief lineair is. Dit punt moet empirisch worden bepaald voor verschillende reacties vanwege de talrijke factoren die de efficiëntie van de amplificatie kunnen beïnvloeden. Omdat de meting vóór het reactieplateau wordt gedaan, gebruikt kwantitatieve PCR minder amplificatiecycli dan basis-PCR. Dit kan problemen veroorzaken bij het detecteren van het eindproduct, omdat er minder product te detecteren is.

Om de efficiëntie van de amplificatie te bewaken, zijn veel toepassingen ontworpen om een ​​interne standaard in de PCR op te nemen. Eén zo'n benadering omvat een tweede primerpaar dat specifiek is voor een "huishoudelijk"-gen (d.w.z. een gen dat constante expressieniveaus heeft tussen de vergeleken monsters) in de reactie (Gaudette en Crain, 1991 Murphy et al. 1990). Amplificatie van huishoudgenen verifieert dat het doelnucleïnezuur en de reactiecomponenten van acceptabele kwaliteit waren, maar houdt geen rekening met verschillen in amplificatie-efficiëntie als gevolg van verschillen in productgrootte of primer-annealingsefficiëntie tussen de interne standaard en het doelwit dat wordt gekwantificeerd.

Het concept van competitieve PCR & mdasha-variatie van kwantitatieve PCR & mdashi is een antwoord op deze beperking. Bij competitieve PCR wordt een bekende hoeveelheid van een controlematrijs aan de reactie toegevoegd. Deze matrijs wordt geamplificeerd met hetzelfde primerpaar als het experimentele doelmolecuul, maar levert een te onderscheiden product op (bijv. verschillende grootte, restrictiedigestiepatroon, enz.). De hoeveelheden controle- en testproduct worden na amplificatie vergeleken. Hoewel deze benaderingen de kwaliteit van het doelnucleïnezuur, de buffercomponenten en de efficiëntie van primer-annealing controleren, hebben ze hun eigen beperkingen (Siebert en Larrick, 1993 McCulloch et al. 1995), inclusief het feit dat velen afhankelijk zijn van definitieve analyse door elektroforese.

Er bestaan ​​talrijke fluorescerende en vaste-fase-assays om de hoeveelheid amplificatieproduct gegenereerd in elke reactie te meten, maar ze slagen er vaak niet in om geamplificeerd DNA van belang te onderscheiden van niet-specifieke amplificatieproducten. Sommige van deze analyses zijn gebaseerd op blottechnieken, die een andere variabele introduceren vanwege de efficiëntie van nucleïnezuuroverdracht, terwijl andere testen werden ontwikkeld om de noodzaak van gelelektroforese te elimineren en toch de vereiste specificiteit te bieden. Real-time PCR, die de mogelijkheid biedt om de resultaten van elke amplificatiecyclus te bekijken, is een populaire manier om de behoefte aan analyse door elektroforese te overwinnen.

Kwantitatieve realtime PCR

Het gebruik van fluorescent gelabelde oligonucleotide-probes of -primers of fluorescerende DNA-bindende kleurstoffen om een ​​PCR-product te detecteren en te kwantificeren, maakt het mogelijk om kwantitatieve PCR in realtime uit te voeren. Speciaal ontworpen instrumenten voeren zowel thermische cycli uit om het doel te versterken als fluorescentiedetectie om de accumulatie van PCR-producten te controleren. DNA-bindende kleurstoffen zijn gemakkelijk te gebruiken, maar maken geen onderscheid tussen specifieke en niet-specifieke PCR-producten en zijn niet bevorderlijk voor multiplexreacties. Fluorescerend gelabelde nucleïnezuurprobes hebben het voordeel dat ze alleen met specifieke PCR-producten reageren, maar ze kunnen duur en moeilijk te ontwerpen zijn. Sommige qPCR-technologieën gebruiken fluorescent gelabelde PCR-primers in plaats van sondes.

Het gebruik van fluorescerende DNA-bindende kleurstoffen is een van de gemakkelijkste qPCR-benaderingen. De kleurstof wordt eenvoudig aan de reactie toegevoegd en de fluorescentie wordt bij elke PCR-cyclus gemeten. Omdat de fluorescentie van deze kleurstoffen dramatisch toeneemt in de aanwezigheid van dubbelstrengs DNA, kan de DNA-synthese worden gevolgd als een toename van het fluorescentiesignaal. Er moet echter vaak voorbereidend werk worden gedaan om ervoor te zorgen dat de PCR-omstandigheden alleen een specifiek product opleveren. In daaropvolgende reacties kan specifieke amplificatie worden geverifieerd door een smeltcurve-analyse. Thermische smeltkrommen worden gegenereerd door alle producten dubbelstrengs DNA te laten vormen bij een lagere temperatuur (ongeveer 60 °C) en de temperatuur langzaam op te voeren tot denaturerende niveaus (ongeveer 95 °C). De productlengte en -volgorde beïnvloeden de smelttemperatuur (Tm), dus de smeltcurve wordt gebruikt om de amplicon-homogeniteit te karakteriseren. Niet-specifieke amplificatie kan worden geïdentificeerd door brede pieken in de smeltcurve of pieken met onverwachte Tm-waarden. Door onderscheid te maken tussen specifieke en niet-specifieke amplificatieproducten, voegt de smeltcurve een kwaliteitscontroleaspect toe tijdens routinematig gebruik. Het genereren van smeltkrommen is niet mogelijk met testen die afhankelijk zijn van de 5&prime&rarr3&prime exonuclease-activiteit van Taq DNA-polymerase, zoals de op probes gebaseerde TaqMan®-technologie.

Sommige qPCR-strategieën maken gebruik van complementaire nucleïnezuurprobes om het DNA-doelwit te kwantificeren. Deze sondes kunnen ook worden gebruikt om polymorfismen van één nucleotide te detecteren (Lee et al. 1993 Bernard et al. 1998). Er zijn verschillende algemene categorieën van real-time PCR-probes, waaronder hydrolyse-, haarspeld- en eenvoudige hybridisatieprobes. Deze sondes bevatten een complementaire sequentie die de sonde in staat stelt om aan het accumulerende PCR-product te hechten, maar sondes kunnen verschillen in het aantal en de locatie van de fluorescerende reporters.

Hydrolyseprobes zijn gelabeld met een fluor aan het 5&prime-uiteinde en een quencher aan het 3&prime-uiteinde, en omdat de twee reporters dicht bij elkaar zijn, wordt het fluorescentiesignaal gedoofd. Tijdens de annealingstap hybridiseert de probe met het PCR-product dat in eerdere amplificatiecycli is gegenereerd. De resulterende probe:target-hybride is een substraat voor de 5&prime&rarr3&prime exonuclease-activiteit van het DNA-polymerase, dat de gegloeide sonde afbreekt en de fluor vrijmaakt. et al. 1991). De fluor wordt bevrijd van de effecten van de energie-absorberende quencher en de voortgang van de reactie en accumulatie van PCR-product wordt gevolgd door de resulterende toename in fluorescentie. Met deze benadering moeten voorafgaande experimenten worden uitgevoerd voorafgaand aan de kwantificatie-experimenten om aan te tonen dat het gegenereerde signaal evenredig is met de hoeveelheid van het gewenste PCR-product en dat niet-specifieke amplificatie niet optreedt.

Haarspeldprobes, ook wel moleculaire bakens genoemd, bevatten omgekeerde herhalingen, gescheiden door een sequentie die complementair is aan het doel-DNA. De herhalingen gloeien om een ​​haarspeldstructuur te vormen, waarbij de fluor aan het 5&prime-uiteinde en een quencher aan het 3&prime-uiteinde dicht bij elkaar zijn, wat resulteert in weinig fluorescerend signaal. De haarspeld-sonde is zo ontworpen dat de sonde bij voorkeur aan het doel-DNA bindt in plaats van de haarspeldstructuur te behouden. Naarmate de reactie vordert, gloeien toenemende hoeveelheden van de sonde aan het accumulerende PCR-product, en als resultaat worden de fluor en de quencher fysiek gescheiden. De fluor wordt niet langer gedoofd en het fluorescentieniveau neemt toe. Een voordeel van deze techniek is dat haarspeldsondes minder snel mismatchen dan hydrolysesondes (Tyagi et al. 1998). Er moeten echter voorlopige experimenten worden uitgevoerd om aan te tonen dat het signaal specifiek is voor het gewenste PCR-product en dat er geen niet-specifieke amplificatie optreedt.

Het gebruik van eenvoudige hybridisatieprobes omvat twee gelabelde probes of als alternatief één gelabelde probe en een gelabelde PCR-primer. In de eerste benadering wordt de energie die door de fluor op één sonde wordt uitgezonden, geabsorbeerd door een fluor op de tweede sonde, die in de buurt hybridiseert. Bij de tweede benadering wordt de uitgezonden energie geabsorbeerd door een tweede fluor die als onderdeel van de primer in het PCR-product wordt opgenomen. Beide benaderingen resulteren in verhoogde fluorescentie van de energieacceptor en verminderde fluorescentie van de energiedonor. Het gebruik van hybridisatieprobes kan nog verder worden vereenvoudigd, zodat slechts één gelabelde probe nodig is. In deze benadering wordt het doven van de fluor door deoxyguanosine gebruikt om een ​​verandering in fluorescentie teweeg te brengen (Crockett en Wittwer, 2001 Kurata et al. 2001). De gelabelde sonde gloeit zodat de fluor zich in de buurt van G-residuen in de doelsequentie bevindt, en naarmate de sondegloeiing toeneemt, neemt de fluorescentie af als gevolg van het uitdoven van deoxyguanosine. Met deze benadering is de locatie van de sonde beperkt omdat de sonde moet hybridiseren zodat de fluorescerende kleurstof zeer dicht bij een G-residu is. Het voordeel van eenvoudige hybridisatieprobes is dat ze gemakkelijker kunnen worden gemultiplext dan hydrolyse- en haarspeldprobes door het gebruik van verschillend gekleurde fluors en probes met verschillende smelttemperaturen (besproken in Wittwer et al. 2001).

Sommige qPCR-strategieën maken gebruik van complementaire nucleïnezuurprobes om het DNA-doelwit te kwantificeren. Deze sondes kunnen ook worden gebruikt om polymorfismen van één nucleotide te detecteren (Lee et al . 1993 Bernard et al . 1998). Er zijn verschillende algemene categorieën van real-time PCR-probes, waaronder hydrolyse-, haarspeld- en eenvoudige hybridisatieprobes. Deze sondes bevatten een complementaire sequentie die de sonde in staat stelt om aan het accumulerende PCR-product te hechten, maar sondes kunnen verschillen in het aantal en de locatie van de fluorescerende reporters.

QPCR-producten en -bronnen

GoTaq® qPCR- en RT-qPCR-kits zijn beschikbaar voor op kleurstof gebaseerde of op sonde gebaseerde realtime PCR-benaderingen. GoTaq qPCR-systemen bevatten BRYT Green Dye, die maximale versterkingsefficiëntie en grotere fluorescentie biedt dan SYBR Green.

GoTaq®-sondesystemen zijn gebruiksklare mastermixen die het samenstellen van reacties vereenvoudigen voor detectie op basis van hydrolysesondes.


Waarom mogen primers geen Tm-verschil hebben dat groter is dan 5 °C? - (29/09/2011 )

Tm voor mijn forward primers is 73C en voor de reverse is 53C.

Primer F
TGCAGGCGCCCCGAGTGCTGC

Primer R
CGTCACTAGTGTCGTCTACTA

Afgezien van het feit dat Tm 73C zelfs hoger is dan de verlengingstemperatuur (68C voor pfx DNA-polymerase), vertellen de Tm-calculators me dat het verschil tussen de Tm-temperaturen groter is dan de aanbevolen 5C en daarom zal de PCR niet werken.

Tm vertelt je bij welke temperatuur je de helft van je primer gesmolten zult hebben (d.w.z. niet-bindend template-DNA). Ta is gekozen om lager te zijn dan Tm, dus de meeste van je primers binden het DNA. Hoe lager je gaat met de temperatuur, hoe groter de kans dat je primer niet-specifiek zou binden (aan een niet-complementaire sequentie). Je moet dus de juiste gloeitemperatuur kiezen, niet zo hoog (geen versterking) niet zo laag (niet-specifiek).
Als je primers hebt met zo'n verschillende Tm, kun je geen optimale temperatuur hebben om beide primers te laten binden.
IMO.

Maar is er een kans dat het werkt?

Er is altijd een kans. Er zijn veel manieren om Tm te berekenen en sommige verschillen erg. En de werkelijke situatie hangt ook af van de sjabloon en wie weet wat nog meer.
Maar ik zou niet te optimistisch zijn, het is 20 graden. Je F-primersequentie is zeer zelfcomplementair, dus je zou een hogere Ta nodig hebben om het te ontspannen, maar op dat moment zou je R-primer waarschijnlijk helemaal niet aan het DNA binden.
Je kunt het proberen, maar als het niet werkt, is het waarschijnlijk sneller en goedkoper om nieuwe primers te ontwerpen.

Ik begrijp het punt dat Trof probeert te maken, en ik ben het ermee eens dat als de PCR niet werkt en je de mogelijkheid hebt, ik zou proberen om verschillende primers opnieuw te ontwerpen met nauwere Tm-waarden. U zou bijvoorbeeld de laatste "GC" van uw voorwaartse primer kunnen verwijderen en dat zou uw Tm met ongeveer 8 graden verlagen. Dat gezegd hebbende, ik heb situaties gehad waarin ik geen keus had om twee primers met sterk verschillende Tm-waarden te gebruiken en de PCR goed te laten werken. U moet altijd binnen de grenzen van uw laagste Tm-primer werken, wat betekent dat u waarschijnlijk een uitgloeitemperatuur van 50-54 graden moet gebruiken. Bovendien heb ik ontdekt dat het werken met primers met een hoge Tm betekent dat je misschien je denaturatiestap wilt verlengen. De meeste polymerasen hebben een aanbevolen tijdsbereik (bijvoorbeeld 95 graden voor 10-30 s). Als ik een primer heb met een Tm boven de 65, verleng ik meestal mijn denaturatiestap in het fietsen tot 30 graden en ik merk dat het helpt.

De gradiënt-PCR is mislukt. Ik heb de temps ingesteld van 40C tot 65C, maar het produceerde geen band. Ik heb ook een 2-staps PCR uitgevoerd, ik speelde met de denaturatietijd zoals aanbevolen door allynspear, maar het faalde ook. Ik denk dat ik nieuwe primers ga ontwerpen.


Hoe bereken je de gloeitemperatuur voor PCR?

De gloeitemperatuur (Teen) gekozen voor PCR is direct afhankelijk van de lengte en samenstelling van de primers. Over het algemeen moet u een gloeitemperatuur gebruiken die ongeveer 5°C onder de T . ligtm van uw primers. De optimale gloeitemperatuur (Teen Opt) voor een bepaald primerpaar op een bepaald doelwit kan als volgt worden berekend: Teen Opt = 0,3 x (Tm van primer) + 0,7 x (Tm van product) &ndash 14.9 waar Tm van primer is de smelttemperatuur van het minder stabiele primer-sjabloonpaar, en Tm van product is de smelttemperatuur van het PCR-product [1].

Een gevolg van het hebben van Teen te laag is dat een of beide primers zullen hybridiseren met andere sequenties dan het beoogde doel, omdat interne mismatches van een enkele base of gedeeltelijke annealing getolereerd kunnen worden. Dit kan leiden tot niet-specifieke PCR-amplificatie en zal bijgevolg de opbrengst van het gewenste product verminderen. Omgekeerd, wanneer Teen een te hoge reactie-efficiëntie kan worden verminderd, omdat de kans op primer-annealing aanzienlijk wordt verminderd. Optimale gloeitemperaturen geven de hoogste productopbrengst van het juiste amplicon.


Snelle qPCR – 5 manieren om uw qPCR sneller klaar te krijgen

Dit zijn niet de gebruikelijke tips zoals het aliquoteren van primers, het gebruik van aangewezen gebieden (driekamerregel) en apparatuur voor de pre- en post-amplificatiestappen om het risico op besmettingen te verminderen. Dus laten we erop ingaan!

1. Kies een hogere GC-inhoud voor uw sjabloon - qPCR-snelheid hangt ervan af

Het is misschien niet altijd haalbaar, maar kies indien mogelijk voor amplicons met: hogere GC-inhoud. Het gemiddelde verlengingspercentage voor guanine (G) en cytosine (C) bleek 2,8 keer hoger dan voor adenine (A) en thymine (T) bij temperaturen tot 75°C. Het optimale GC-gehalte is rond 60%. Hier werden de hoogste extensiesnelheden waargenomen tussen 70°C en 75°C (bij temperaturen onder 70°C en boven 75°C vertoonden de extensiesnelheden een bijna lineaire afname).

Voor sjablonen met een laag GC-gehalte of GC-gehalte groter dan 60% nemen de uitbreidingspercentages af. Hier heeft een hoog GC-gehalte meer impact dan een laag GC-gehalte, waarschijnlijk door de vorming van secundaire structuren in het uitbreidingsgebied.

Het is echter cruciaal om verschillende GC-inhoud testen voor het gebruikte polymerase. Native en een deletievariant van Taq-polymerase vertoonden verhoogde verlengingspercentages met toenemend GC-gehalte (tot ongeveer 80%), terwijl een Pfu-polymerasevariant verminderde verlengingspercentages vertoonde met toenemend GC-gehalte bij 75°C (Montgomery et al., 2014).

Over het algemeen is het de moeite waard om te controleren of een hoger GC-gehalte van het amplicon de verlengingstijd van elke cyclus zou kunnen verkorten.

2. Kies verstandig de mastermix voor uw qPCR

Als het om snelheid gaat, is het gebruik van dUTP als vervanging voor dTTP in de mastermix moet worden vermeden. De opname van uracil (U) is gemiddeld 50% langzamer dan van T bij temperaturen tot 65°C. De verhoging van de U-concentratie in de mastermix had geen positief effect op de opnamesnelheid en verminderde deze zelfs (Montgomery et al., 2014).

Ook de pH van de reactie heeft een grote invloed op de verlengingssnelheden. Het ideale bereik is echter smal en tussen pH 8.5 en pH 8.7. Onder pH 8,5 nemen de verlengingspercentages aanzienlijk af: ongeveer 60% bij elke pH-eenheid. Boven het ideale pH-bereik nemen de verlengingssnelheden nog aanzienlijk af en worden ze bijna volledig geremd bij pH 7 (Montgomery et al., 2013).

Andere zeer invloedrijke factoren op het verlengingspercentage zijn: magnesium chloride (MgCl 2 ) en kaliumchloride (KCL) concentraties. Hoge MgCl2-concentraties van 3 tot 6 mM leiden tot hogere verlengingspercentages. In het bijzonder een 1,5 mM MgCl2 concentratie blijkt te resulteren in een ongeveer 50% korting van de verlengingssnelheid vergeleken met een concentratie van 5 mM.

Hoge concentraties van KCl, echter, sterk remmen polymerase-activiteit. Er is een afname van meer dan 70% in extensiesnelheid waargenomen bij een KCl-concentratie van 37,5 mM vergeleken met 0 mM. De grootste polymerase-activiteit is gevonden wanneer KCl afwezig is of bij de laagste concentratie (Montgomery et al., 2013 Montgomery en Wittwer, 2014).

Wanneer het GC-gehalte van het amplicon hoger is, wordt toevoeging van DMSO bij 5% of 7,5% kan de amplificatie verbeteren door secundaire structuren te verminderen. Het is echter gebleken dat het gebruik van 10% DMSO de verlengingspercentages verlaagt (Montgomery et al.,2014 Montgomery en Wittwer, 2014)!

Daarom is het essentieel voor de qPCR-snelheid om de pH en de MgCl2- en KCl-concentraties van de mastermix aan te passen.

Een ander punt om te overwegen is het kiezen van de geschikte kleurstofconcentratie: voor qPCR-reacties. Niet-covalente kleurstoffen verminderen de verlengingssnelheid en het is aangetoond dat een lagere concentratie van deze kleurstoffen de verlenging versnelt. Lagere kleurstofconcentraties resulteren echter in lagere signaalsterkten en kunnen alleen worden gebruikt als de gevoeligheid van de optische sensor van de qPCR-cycler groot genoeg is (Montgomery en Wittwer, 2014). Het bewijs van de pudding zit dus in het eten.

3. Verkort de cyclustijd en minimaliseer de temperatuurverschillen van de

stappen in uw qPCR

De looptijd van een qPCR hangt sterk af van de aanloopsnelheden, de tijd die de cycler nodig heeft om tussen temperaturen te wisselen. Een vermindering van de temperatuurverschillen kan een behoorlijke impact hebben!

Het is aangetoond dat succesvolle PCR-resultaten kunnen worden gegenereerd met redelijk brede tijdsomstandigheden en temperatuurbereik. Bustin (2017) testte zes verschillende qPCR-cycluscondities voor zes willekeurig geselecteerde genen in een borstkankercellijn (MCF-7) op twee verschillende qPCR-cyclers. Denaturatietijd en temperaturen, evenals annealing / verlengingstijd en temperatuur werden vrij breed gevarieerd (Tabel 1) en genereerden (verrassend) ongeveer hetzelfde aantal kwantificatiecycli (Cqs), ook wel drempelcyclus (Ct) genoemd.

Tabel 1: Verschillende qPCR-reactieomstandigheden voor testen die parallel zijn uitgevoerd op twee verschillende qPCR-cyclers.

Denaturatie Gloeien/polymerisatie

95 °C gedurende 5 seconden 60 °C gedurende 15 seconden

93°C gedurende 1 seconde 60°C gedurende 5 seconden

93°C gedurende 1 seconde 60°C gedurende 1 seconde

90°C gedurende 1 seconde 60°C gedurende 15 seconden

90°C gedurende 1 seconde 60°C gedurende 1 seconde

88°C gedurende 1 seconde 60°C gedurende 1 seconde

Smeltcurve-analyse gaf aan dat dezelfde amplicons werden geproduceerd onder alle verschillende omstandigheden, behalve voor Ubiquitine C op een van de cyclers.

Concluderend toonde dit aan dat goede qPCR-resultaten kan worden verkregen met lagere denaturatietemperaturen en kortere denaturatie- en gloei-/verlengtijden! De tijd om een ​​run van 40 cycli uit te voeren met aangepaste omstandigheden zoals beschreven duurde slechts ongeveer 60% van de tijd van een run met standaardcondities (Bustin, 2017).

4. Kies betrouwbare en geteste ontwerptools voor een perfecte PCR-primer en

qPCR-assays

Betrouwbaar en beproefd en getest van Eurofins Genomics Ontwerptools voor PCR-primers zijn gebaseerd op "Prime+" van het GCG Wisconsin-pakket dat oorspronkelijk is geschreven door Irv Edelman, uitgebreid met aanvullende parameters voor perfect PCR-primer en probe-ontwerp.

Bij het selecteren van geschikte PCR-primer/probe-combinaties voor genotypering en genexpressie-assays, wordt een verscheidenheid aan beperkingen op de PCR-primer, sonde en geamplificeerd product beschouwd en gedeeltelijk vooraf gedefinieerd als standaardwaarden in ons qPCR-assayontwerp. Voor de bi-plex qPCR-assayontwerp worden alle primers en probes opnieuw tegen elkaar gecontroleerd. De resultaten worden gescoord volgens de best voorspelde prestatiecriteria.

Voor uw gemak kunt u direct bestellen de geselecteerde PCR-primerparen of PCR-primer/probe-combinaties in onze winkel.

5. Snelle PCR-primers om uw qPCR-project te versnellen

Eurofins Genomics hoge kwaliteit NightXpress (q)PCR-primers zal de voltooiing van uw qPCR-project vergroten. Bestel vandaag en ze worden geleverd in minder dan 24 uur! U kunt dus vrijwel onmiddellijk beginnen met uw op qPCR gebaseerde onderzoek.

(q)PCR Primer NightXpress is geschikt voor alle soorten standaard en realtime PCR. Wij garanderen nauwkeurige en betrouwbare primerhoeveelheden met een hoge zuiverheid. Ook geeft de lage zoutconcentratie van deze primers stabiele smelttemperaturen (Tm).

Bonustip om de publicatie van uw qPCR-resultaten te versnellen:

Gebruik de MIQE-richtlijnen

De minimale informatie voor publicatie van kwantitatieve real-time PCR-experimenten (MIQE) richtlijnen bieden methoden voor het ontwerp van qPCR-experimenten om consistentie bij het publiceren van gegevens te garanderen. Het naleven van deze richtlijnen zal helpen bij het genereren van betrouwbare qPCR-gegevens die vergelijkbaar en reproduceerbaar zijn (consistentie tussen experimenten) (Bustin et al., 2009). Het zal ook bijdragen aan het verkrijgen van uw gegevens gepubliceerd.

Door Dr. Andreas Ebertz

- Bustin, S.A. (2017) Hoe de polymerasekettingreactie te versnellen. Biomol Detect Quantif. 12: 10-4.

- Bustin, SA, Benes, V., Garson, JA, Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, MW, Shipley, GL, Vandesompele, J ., Witter, CT

(2009) De MIQE-richtlijnen: minimale informatie voor publicatie van kwantitatieve realtime PCR-experimenten. clin. Chem. 55 (4): 611-22.


PCR - verminderde bindingsefficiëntie met lagere Tm? - (29/02/2008 )

Ik weet dat de gebruikelijke regel voor PCR is dat een hogere smelttemperatuur de specificiteit van primerbinding verhoogt (en het moeilijker maakt voor primers om te binden aan een minder dan perfect overeenkomende sequentie) en vice versa (dus bij een lagere temperatuur u kunt meerdere banden krijgen van veel niet-specifieke binding).

Heeft iemand ooit gehoord dat het tegenovergestelde gebeurt?? Ik heb al een tijdje problemen met een bepaalde primerset en in sommige gevallen resulteert een lagere smelttemperatuur in negatieven die positief waren bij een hogere smelttemperatuur. Ik ben erg in de war.

Ik weet dat de gebruikelijke regel voor PCR is dat een hogere smelttemperatuur de specificiteit van primerbinding verhoogt (en het moeilijker maakt voor primers om te binden aan een minder dan perfect overeenkomende sequentie) en vice versa (dus bij een lagere temperatuur u kunt meerdere banden krijgen van veel niet-specifieke binding).

Heeft iemand ooit gehoord dat het tegenovergestelde gebeurt?? Ik heb al een tijdje problemen met een bepaalde primerset en in sommige gevallen resulteert een lagere smelttemperatuur in negatieven die positief waren bij een hogere smelttemperatuur. Ik ben erg in de war.

Weet je zeker of wat jij als positief ziet ook echt positief is? Het kan niet gebeuren dat wat je ziet onspecifiek is en wanneer je de temperatuur verhoogt, verdwijnt??

Ik weet dat de gebruikelijke regel voor PCR is dat een hogere smelttemperatuur de specificiteit van primerbinding verhoogt (en het moeilijker maakt voor primers om te binden aan een minder dan perfect overeenkomende sequentie) en vice versa (dus bij een lagere temperatuur u kunt meerdere banden krijgen van veel niet-specifieke binding).

Heeft iemand ooit gehoord dat het tegenovergestelde gebeurt?? Ik heb al een tijdje problemen met een bepaalde primerset en in sommige gevallen resulteert een lagere smelttemperatuur in negatieven die positief waren bij een hogere smelttemperatuur. Ik ben erg in de war.

Bij suppressie-PCR (er werd slechts een enkele primer gebruikt die overeenkomt met de omgekeerde terminale herhalingen van het doelwit), kan een verlaagde annealingstemperatuur de efficiëntie van primer-template annealing verminderen.


Polymerasekettingreactie (PCR)

De polymerasekettingreactie (PCR) is een methode om snel DNA-sequenties te amplificeren. Tijdens een typische PCR wordt matrijs-DNA (dat het interessegebied bevat) gemengd met deoxynucleotiden (dNTP's), een DNA-polymerase en primers. Primers zijn korte DNA-segmenten die complementair zijn met het matrijs-DNA stroomopwaarts van het interessegebied en dienen als rekruteringsplaatsen voor het polymerase. PCR omvat een reeks temperatuurcycli die, hoewel ze ooit werden uitgevoerd door buizen door verschillende waterbaden te bewegen, nu automatisch worden geregeld door het gebruik van thermische cyclers of thermocyclers. Thermocyclers bieden strakke controle over zowel de reactietemperatuur als de duur van elke temperatuurstap, waardoor een efficiënte amplificatie wordt gegarandeerd. Tijdens een typische PCR worden cycli van denaturatie, annealing en verlenging herhaald om exponentiële amplificatie van de doelsequentie te bereiken. Denaturatie bestaat uit het opwarmen van de monsters tussen 94-98°C om denaturatie van het matrijs-DNA te veroorzaken, waardoor de waterstofbruggen en base-stapelingsinteracties die de DNA-strengen bij elkaar houden, worden verstoord. Zodra de strengen zijn gescheiden, wordt de temperatuur verlaagd tot de annealingstemperatuur om de primers in staat te stellen basenparen (of annealen) te maken met complementaire gebieden van de template. De annealingstemperatuur (meestal tussen 48-72°C) is gerelateerd aan de smelttemperatuur (Tm) van de primers en moet worden bepaald voor elk primerpaar dat in PCR wordt gebruikt. Tijdens de verlengingsstap (typisch 68-72°C) verlengt het polymerase de primer om een ​​ontluikende DNA-streng te vormen. Dit proces wordt meerdere keren herhaald (meestal 25-35 cycli), en omdat elke nieuwe streng ook kan dienen als een sjabloon voor de primers, wordt het interessegebied exponentieel geamplificeerd. De laatste stap van de PCR is over het algemeen een langere stap met een enkele temperatuur (vaak 5-10 minuten bij 68-72°C) die de voltooiing van eventuele gedeeltelijke kopieën en de verwijdering van alle replicatiemachines van het ontluikende DNA mogelijk maakt. Zodra de PCR is voltooid, wordt de thermische cycler ingesteld op 4°-10°C om de productintegriteit te behouden totdat de buizen uit de machine kunnen worden verwijderd.


Invoering

De amplificatie van doel-DNA-sequenties met een hoog GC-gehalte (>60%) kan een obstakel zijn voor een succesvolle PCR. Dit probleem wordt gecompliceerd door de hoge waarschijnlijkheid van het vormen van secundaire structuren zoals haarspeld in DNA-templates, zelf- en cross-primerdimeervorming. Dergelijke structuren kunnen het DNA-polymerase blokkeren en/of voorkomen dat primers aan de matrijzen versmelten, waardoor de synthese van de nieuwe DNA-streng tijdens PCR wordt beëindigd. Bovendien kan het klonen van genen met een hoog GC-gehalte door PCR met behulp van lange primers een extra uitdaging vormen voor het amplificatieproces vanwege de hoge smelttemperatuur (Tm) vanwege de extra waterstofbinding tussen cytosine- en guanine-basenparen (Borah, 2011).

Studies die erop gericht waren deze problemen te overwinnen, gaven speciale aandacht aan de primers, versterkeroplossingen en cyclische omstandigheden. Het wordt aanbevolen om de lengte van de primers tussen 15 en 30 nucleotideresiduen (basen) te houden en de Tm tussen 52 en 58 °C. (Borah, 2011). De toevoeging van versterkers zoals betaïne, dimethylsulfoxide (DMSO) en formamide kan het smeltkarakter van de dubbelstrengs DNA-helices wijzigen, waardoor de strengen gemakkelijk kunnen worden gescheiden. Betaïne is een aminozuuranalogon dat de energie vermindert die nodig is voor de denaturatie van DNA-strengen. DMSO interfereert met de vorming van waterstofbruggen en voorkomt hernieuwde annealing tussen en binnen de strengen. (Jensen et al., 2010 Ralser et al., 2006 Rees et al., 1993). Formamide verhoogt de PCR-specificiteit bij het werken met GC-rijke doelen (Sarkar et al., 1990). Aanpassing van cyclische omstandigheden wordt ook overwogen, dit omvat het optimaliseren van de uitgloeitemperatuur, het toepassen van Hot start PCR en het gebruik van geneste PCR en touchdown PCR (Don et al., 1991 Lorenz, 2012).

Opgemerkt wordt dat zelfs bij het toepassen van de eerder genoemde benaderingen, er nog steeds uitdagingen op het gebied van amplificatie bestaan, vooral bij het gebruik van GC-rijke sjablonen, lange primers en het streven naar het amplificeren van langere producten. Bovendien richt de meeste gepubliceerde literatuur zich op de amplificatie van genen van minder dan 1 kilobase en optimalisatie van de voorwaarden met betrekking tot een enkel PCR-product (Frey et al., 2008 Jensen et al., 2010 Kumar et al., 2014 Mamedov et al. ., 2008 Ralser et al., 2006) gaan ze echter niet in op het werken met meerdere lange GC-rijke doelen (>1 kb). In de context van een ander project in ons laboratorium dat gericht is op amplificatie en klonering van meerdere GC-rijke ORF's uit de Mycobacterium bovis genome, a standard procedure that enables amplification of these targets simultaneously was required without the need to optimize individual conditions for each target. This provoked us to design this study that tested and compared the PCR amplification of one “difficult” target as a model, Mb0129 van M. bovis, a large-sized gene 1794 bp and a GC content 77.5%, and two relatively “easier” targets, mpb83 (Mb2898) van M. bovis, a 663 bp gene and 63% GC content, and LMHCC_RS00060 van Listeria monocytogenes, a 1617 bp gene and 41.5% GC. Three PCR protocols were designed and experimented with each of the three genes using five different polymerase enzymes in the presence or absence of enhancers.


Ondersteunende informatie

S1 Fig. Sequencing workflow using targeted-amplicon sequencing (TAS) (A) and the polymerase-exonuclease-PCR (PEX PCR) method (B).

The TAS workflow consists of two PCR stages in which template-specific primers containing 5’ linker sequences are used to amplify from template DNA. Subsequently, an aliquot of the first PCR is transferred to a second reaction for amplification with primers containing NGS sequencing adapters and a sample-specific barcode. In the PEX PCR method, a modified workflow is used the first stage reaction is truncated after 2 cycles, primers are removed using exonuclease digestion, and the exonuclease-treated reaction mixture is subsequently PCR-amplified with primers containing sequencing adapters and barcodes. AT = annealing temperature ET = Elongation time.

S2 Fig. Effect of 5-nitroindole substitution and amplification strategy on observed microbial community structure and primer utilization patterns.

(EEN) Non-metric multidimensional scaling (NMDS) plot of lake sediment microbiome, performed at the taxonomic level of family and based on Bray-Curtis similarity (2D stress = 0.02). Samples were rarefied to 4,750 sequences per sample and no transformation was applied. Symbols are color-coded by the diversity (Shannon Index) of reverse primers (l.e. 806R) detected in the sequences. Maximum possible Shannon index for 18 primers in the primer pool is 2.89. Reactions in which the 806R primer with 5-nitroindole (806R-NI) substitutions was used were less reproducible. (B) Group-average dendogram of observed lake sediment microbial community structure from a single sample as amplification method is altered. gDNA was PCR amplified using the standard TAS reaction and with PEX PCR reactions with and without exonuclease and with and without primers containing 5-nitroindole substitutions. Bray-Curtis similarity scores were generated based on family-level taxonomic classification, generated as described in the text. Data were standardized but not transformed. Clusters containing all three replicates from a single treatment are indicated by a symbol at the node. (C) Dendogram and heatmap of reverse (806R) primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. A separate column (at the very bottom) indicates the relative abundance of variants potentially present when 5-nitroindole primers are used.

S3 Fig. Effect of method and annealing temperature on primer utilization patterns in mock DNA.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures from 30°-55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. All reactions using the TAS method clustered together (node indicated by a blue circle). Underlined samples are analyzed at the individual template level in S4 Fig.

S4 Fig. Effect of method and annealing temperature on primer utilization patterns for each mock template.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures of 45° and 55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each template within the mock community DNA pool, with primers ordered by increasing theoretical Tm.

S5 Fig. Effect of annealing temperature on observed microbial community structure and primer utilization patterns.

(EEN) Group-average dendogram of observed mammalian fecal microbial community structure from a single sample (“Chin”) as PEX PCR stage 1 annealing temperature is altered. Labeled nodes indicate grouping of replicates from a single annealing temperature (* indicates a single replicate from 55°C is included). Bray-Curtis similarity scores were generated based on family-level biological data, generated as described in the text. Data were standardized but not transformed. (B) Dendogram and heatmap of reverse primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap (0–75%) indicates the relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm.


Bekijk de video: Anthony Budiawan: Bisnis Kartel Tes PCR membahayakan posisi Presiden . indosatu news (Augustus 2022).